Skip to main content
Ch. 15 - Recombinant DNA Technology and Its Applications
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook
Chapter 15, Problem 28

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC

Verified step by step guidance
1
span>Step 1: Identify the sequences provided. The first sequence is the one used to produce the B chain of human insulin in E. coli, and the second sequence is from a cDNA isolated from a human pancreatic cDNA library.
span>Step 2: Compare the sequences nucleotide by nucleotide to identify any differences. Look for substitutions, insertions, or deletions between the two sequences.
span>Step 3: Consider the context of the sequences. The first sequence might have been optimized for expression in E. coli, which could involve codon optimization or other modifications to enhance expression in a bacterial system.
span>Step 4: Analyze the potential impact of any differences on the protein product. Changes in the DNA sequence can lead to changes in the amino acid sequence of the insulin B chain, potentially affecting its structure and function.
span>Step 5: Reflect on the significance of these differences. Consider why the sequence used in E. coli might differ from the natural human sequence, such as for reasons of expression efficiency, stability, or regulatory requirements.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.
Video duration:
2m
Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

cDNA and Gene Expression

cDNA, or complementary DNA, is synthesized from an mRNA template through the process of reverse transcription. It represents the coding sequence of a gene, excluding introns, and is crucial for understanding gene expression. In this context, the cDNA derived from human pancreatic tissue reflects the mature mRNA that encodes the B chain of insulin, highlighting the differences between the genomic DNA and the expressed sequence.
Recommended video:
Guided course
02:09
Penetrance and Expressivity

E. coli as a Host for Protein Production

E. coli is commonly used as a host organism for the production of recombinant proteins, including insulin. This bacterium can be genetically modified to express human proteins, but it lacks the machinery to splice introns from eukaryotic genes. Therefore, when comparing the sequences, the E. coli version would typically contain only the exons, while the human gene may include introns that are absent in the cDNA.
Recommended video:

Sequence Alignment and Differences

Sequence alignment is a method used to identify similarities and differences between two sequences of DNA or RNA. In this case, comparing the highlighted E. coli sequence with the human cDNA sequence will reveal variations such as missing introns, differences in nucleotide composition, or mutations. Understanding these differences is essential for grasping how the sequences relate to protein synthesis and functionality.
Recommended video:
Guided course
08:41
Sequencing Difficulties
Related Practice
Textbook Question

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What is the height potential of the F₁ progeny of the homozygous plants identified in (a) and (b) of this problem?

483
views
Textbook Question

Vitamin E is the name for a set of chemically related tocopherols, which are lipid-soluble compounds with antioxidant properties. Such antioxidants protect cells against the effects of free radicals created as by-products of energy metabolism in the mitochondrion. Different tocopherols have different biological activities due to differences in their retention by binding to gut proteins during digestion. The one retained at the highest level is α-tocopherol, whereas γ-tocopherol is retained at less than 10% of that efficiency. In Arabidopsis, α-tocopherol is the most abundant tocopherol in leaves, whereas γ-tocopherol is the most abundant in seeds. An enzyme encoded by the VTE4 gene can convert γ-tocopherol to α-tocopherol. How would you create an Arabidopsis plant that produces high levels of α-tocopherol in the seeds?

514
views
Textbook Question

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How can you identify the gene adjacent to the insertion site of the enhancer trap?

573
views
Textbook Question

You have identified an enhancer trap line generated by P element transposition in Drosophila in which the marker gene from the enhancer trap is specifically expressed in the wing imaginal disc.

How would you show that the expression pattern of the enhancer trap line reflects the endogenous gene expression pattern of the adjacent gene?

572
views
Textbook Question

A three-gene system of additive genes (A, B, and C) controls plant height. Each gene has two alleles (A and a, B and b, and C and c). There is dominance among the alleles of each gene, with alleles A, B, and C dominant over a, b, and c. Under this scheme, the dominant genotype for a gene contributes 10 cm to height potential, and the recessive genotype contributes 4 cm. What are the phenotypes and proportions of each phenotype among the F₂?

696
views
Textbook Question

In Drosophila, loss-of-function Ultrabithorax mutations result in the posterior thoracic segments differentiating into body parts with an identity normally found in the anterior thoracic segments. When the Ultrabithorax gene was cloned, it was shown to encode a transcription factor and to be expressed only in the posterior region of the thorax. Thus, Ultrabithorax acts to specify the identity of the posterior thoracic segments. Similar genes were soon discovered in other animals, including mice and humans. You have found that mice possess two closely related genes, Hoxa7 and Hoxb4, which are orthologs of Ultrabithorax. You wish to know whether the two mouse genes act to specify the identity of body segments in mice.

How will you determine whether the mouse genes have redundant functions?

544
views