18. Molecular Genetic Tools
Genetic Cloning
Problem 28a
Textbook Question
Textbook QuestionThe highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.
ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA
GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC
![](/channels/images/assetPage/verifiedSolution.png)
This video solution was recommended by our tutors as helpful for the problem above
Video duration:
2mPlay a video:
168
views
Was this helpful?
Related Videos
Related Practice