A DNA sequence encoding a five-amino acid polypeptide is given below.
...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT...
...TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA...
Give the polypeptide sequence, and identify the N terminus and C terminus.

Verified step by step guidance

1. Identify the coding strand of the DNA sequence. The coding strand is the one that matches the mRNA sequence (except thymine (T) is replaced with uracil (U) in mRNA). In this case, the coding strand is the first strand provided: ...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT....
2. Determine the mRNA sequence by transcribing the coding strand. Replace each thymine (T) in the coding strand with uracil (U). For example, ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT becomes ACGGCAAGAUCCCACCCUAAUCAGACCGUACCAUUCACCUCCU.
3. Divide the mRNA sequence into codons (groups of three nucleotides). For example, the sequence ACGGCAAGAUCCCACCCUAAUCAGACCGUACCAUUCACCUCCU would be divided as ACG, GCA, AGA, UCC, CAC, CCU, AAU, CAG, ACC, GUA, CCA, UUC, ACC, UCC.
4. Translate each codon into its corresponding amino acid using the genetic code table. For example, ACG codes for threonine (Thr), GCA codes for alanine (Ala), and so on. Continue this process for the entire sequence until you have the full polypeptide sequence.
5. Identify the N terminus and C terminus of the polypeptide. The N terminus corresponds to the first amino acid in the sequence (translated from the 5' end of the mRNA), and the C terminus corresponds to the last amino acid in the sequence (translated from the 3' end of the mRNA).

Key Concepts

DNA and RNA Transcription

DNA sequences are transcribed into messenger RNA (mRNA) during the process of transcription. This involves the synthesis of an RNA strand complementary to the DNA template, which carries the genetic information needed for protein synthesis. Understanding this process is crucial for translating DNA sequences into polypeptide sequences.

Translation and Amino Acids

Translation is the process by which the mRNA sequence is decoded to synthesize a polypeptide chain, which is a sequence of amino acids. Each set of three nucleotides (codon) in the mRNA corresponds to a specific amino acid. Recognizing the codon-amino acid relationship is essential for determining the final polypeptide sequence from the given DNA.

Polypeptide Structure: N Terminus and C Terminus

Polypeptides have distinct ends known as the N terminus and C terminus. The N terminus is the end of the polypeptide with a free amino group, while the C terminus has a free carboxyl group. Identifying these termini is important for understanding the orientation and functional properties of the polypeptide.