Skip to main content
Ch. 9 - The Molecular Biology of Translation
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook
Chapter 9, Problem 30c

A DNA sequence encoding a five-amino acid polypeptide is given below.
...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT...
...TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA...
Give the polypeptide sequence, and identify the N terminus and C terminus.

Verified step by step guidance
1
Identify the coding strand of the DNA sequence. The coding strand is the one that matches the mRNA sequence (except thymine (T) is replaced with uracil (U) in mRNA). In this case, the coding strand is the first strand provided: ...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT....
Determine the mRNA sequence by transcribing the coding strand. Replace each thymine (T) in the coding strand with uracil (U). For example, ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT becomes ACGGCAAGAUCCCACCCUAAUCAGACCGUACCAUUCACCUCCU.
Divide the mRNA sequence into codons (groups of three nucleotides). For example, the sequence ACGGCAAGAUCCCACCCUAAUCAGACCGUACCAUUCACCUCCU would be divided as ACG, GCA, AGA, UCC, CAC, CCU, AAU, CAG, ACC, GUA, CCA, UUC, ACC, UCC.
Translate each codon into its corresponding amino acid using the genetic code table. For example, ACG codes for threonine (Thr), GCA codes for alanine (Ala), and so on. Continue this process for the entire sequence until you have the full polypeptide sequence.
Identify the N terminus and C terminus of the polypeptide. The N terminus corresponds to the first amino acid in the sequence (translated from the 5' end of the mRNA), and the C terminus corresponds to the last amino acid in the sequence (translated from the 3' end of the mRNA).

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.
Video duration:
2m
Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

DNA and RNA Transcription

DNA sequences are transcribed into messenger RNA (mRNA) during the process of transcription. This involves the synthesis of an RNA strand complementary to the DNA template, which carries the genetic information needed for protein synthesis. Understanding this process is crucial for translating DNA sequences into polypeptide sequences.
Recommended video:

Translation and Amino Acids

Translation is the process by which the mRNA sequence is decoded to synthesize a polypeptide chain, which is a sequence of amino acids. Each set of three nucleotides (codon) in the mRNA corresponds to a specific amino acid. Recognizing the codon-amino acid relationship is essential for determining the final polypeptide sequence from the given DNA.
Recommended video:
Guided course
04:01
Translation Elongation

Polypeptide Structure: N Terminus and C Terminus

Polypeptides have distinct ends known as the N terminus and C terminus. The N terminus is the end of the polypeptide with a free amino group, while the C terminus has a free carboxyl group. Identifying these termini is important for understanding the orientation and functional properties of the polypeptide.
Recommended video:
Guided course
03:49
Ribosome Structure
Related Practice
Textbook Question

Recombinant human insulin (made by inserting human DNA encoding insulin into E. coli) is one of the most widely used recombinant pharmaceutical products in the world. What segments of the human insulin gene are used to create recombinant bacteria that produce human insulin?

567
views
Textbook Question

A DNA sequence encoding a five-amino acid polypeptide is given below.

...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT...

...TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA...

Locate the sequence encoding the five amino acids of the polypeptide, and identify the template and coding strands of DNA.

573
views
Textbook Question

A DNA sequence encoding a five-amino acid polypeptide is given below.

...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT...

...TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA...

Give the sequence and polarity of the mRNA encoding the polypeptide.

703
views
Textbook Question

A DNA sequence encoding a five-amino acid polypeptide is given below.

...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT...

...TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA...

Assuming the sequence above is a bacterial gene, identify the region encoding the Shine–Dalgarno sequence.

559
views
Textbook Question

A DNA sequence encoding a five-amino acid polypeptide is given below.

...ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT...

...TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA...

What is the function of the Shine–Dalgarno sequence?

514
views
Textbook Question

A portion of the coding strand of DNA for a gene has the sequence

5′-...GGAGAGAATGAATCT...-3′

Write out the template DNA strand sequence and polarity as well as the mRNA sequence and polarity for this gene segment.

924
views