Review of Transcription vs. Translation - Online Tutor, Practice Problems & Exam Prep

Transcription is the process of synthesizing RNA from DNA, resulting in an RNA molecule without a change in macromolecule class, as both are nucleic acids. In contrast, translation uses RNA to produce proteins, marking a shift from nucleic acids to proteins, which are composed of amino acids. Key enzymes include RNA polymerase for transcription and ribosomes for translation. Transcription occurs in the nucleus, while translation takes place in the cytoplasm, with RNA synthesized in the 5' to 3' direction and proteins from the N-terminal to C-terminal ends.

Review of Transcription vs. Translation

In this video, we're going to do a review of transcription and translation. And so we're basically going to be reviewing, comparing, and contrasting transcription and translation. Notice that we have this table down below right here that we're going to fill out, and notice that this column right here is all about transcription, and this column over here is all about translation. In terms of the product that is formed, of course, transcription is going to be the process that uses DNA to build RNA. The product that's formed for transcription is an RNA molecule. In terms of translation, translation is going to be the process of using an RNA molecule to build a protein. The protein is going to be the product that is formed.

Now, in terms of whether there is a macromolecule change or a change in the class of macromolecule, it turns out that with transcription, there's no change in the class because it's going from DNA and using the DNA to build RNA. But DNA and RNA are both nucleic acids. It's going from DNA nucleic acids to RNA nucleic acids. Because they're both nucleic acids, there is no macromolecule change in terms of the classes of macromolecules. However, when it comes to translation, there is a macromolecule class change because we go from having RNA, which are nucleic acids, to having proteins, which are made of amino acids. What you'll see here is that going from nucleic acids to proteins is a change in the macromolecule class.

In terms of the major enzyme or structure that's involved with the process, for transcription, the major enzyme is going to be RNA polymerase, and that is going to be the main enzyme involved with transcription that builds the RNA. For translation, recall that the major enzyme or structure is going to be the ribosome. The ribosome is the primary structure involved with the building of the protein during translation.

In terms of the location of each of these processes, transcription, because it uses DNA to build RNA, and DNA in eukaryotes is found in the nucleus, the location of transcription for eukaryotes is going to be in the nucleus of the eukaryotic cell. Translation, on the other hand, is going to occur in the cytoplasm of the eukaryotic cell in the outside of the nucleus. In terms of the direction of synthesis for the particular molecule that's being made, the RNA molecule during transcription, its direction of synthesis is from 5' to 3'. The RNA molecule will be built from its own 5' end towards its own 3' end. The protein during translation, the direction of its synthesis is going to be from its N-terminal end, where the amino group is, to its C-terminal end, where the carboxyl group is.

This here concludes our brief review of transcription and translation, and we'll be able to get some more practice with transcription and translation as we move forward in our course. So I'll see you all in our next video.

What is the central dogma of molecular biology directly referring to?

• A. Unidirectional Translation.
• B. Multidirectional Translation.
• C. Unidirectional Transcription.
• D. Multidirectional Transcription & Translation.

Consider a DNA template strand of the following sequence:5'-A C T G C C A G G A A T-3'.

A) What is the sequence of the corresponding DNA coding strand?  Include directionality.

   DNA Template Strand: 5'-A C T G C C A G G A A T-3'.

   DNA Coding Strand:

B) What is the sequence of the corresponding mRNA strand?  Include directionality.

   mRNA Strand:

Okay, everyone. Consider a DNA template strand of the following sequence. What is the sequence of the corresponding DNA coding strand, including directionality? Okay. So we have our particular strand of DNA bases here, and we're trying to find the sequence of the coding strand. So remember, when we're talking about transcription and translation, an mRNA or an RNA transcript that is complementary to the template strand. And the coding strand is the other strand that is not used by RNA polymerase. However, the coding strand gets its name because it should have the same code as the RNA being created because it is also complementary to the template strand. But it's a little bit different because remember that RNA has Us instead of Ts, and DNA has Ts instead of Us. So remember that DNA has thymine, while RNA will have uracil. Okay? Don't forget that. Okay. So what we have to do first is we have our template strand here in yellow, and we just need to find the complementary DNA coding strand. So the first thing that I like to do is, I like to identify the ends of the strand of nucleotides, and we know that the template strand and the coding strand should be antiparallel to one another, meaning they're going in different directions. So I can see that this end of the template strand is 5' prime. So I'm going to make this end of the coding strand 3' prime, and this one down here 5' prime. So now, I know for sure that they are antiparallel. So now, I can go through and I can make the complementary bases. So the first base I have here is A, so that means we need a T, and then GACGGTC. Oh, running out of room, I'm going to have to move this. TTA, put my 5' prime back on. Okay. So now if you're doing a worksheet or homework or a test, I would always recommend going back and double-checking that your complementary bases are correct and that you wrote everything down well because that's a super common mistake. So everything looks good to me. So, that is going to be our DNA coding strand complementary to our template strand. So now the next part of the question says, what is the sequence of the corresponding mRNA strand? Again, include directionality. So the mRNA strand that is being created should be complementary to the template strand just like the DNA coding strand. So now, for simplicity, you could just do the same thing and make and figure out which bases are complementary just like we did for the coding strand, or we could just write the code of the DNA coding strand and replace all the Ts with Us. Because if you think about it, the DNA coding strand is complementary to the template strand, and so is the mRNA. We just have to make sure that there are no thymines in our mRNA, and replace those thymines with uracils. So, again, we're just going to pretty much rewrite what we've already got. But instead of a T that I see here and here and right here, I'm just going to replace them with uracils. So we're going to have UGACGGUCCUUA5' prime. And this makes total sense because the directionality is correct. Technically, the mRNA strand is still antiparallel to the DNA template strand, and it has the same code as the coding strand, except it has uracils instead of thymines. Okay, everyone. Hopefully, that makes sense. Let's move on to our next video.

Consider a DNA coding strand with the following sequence: 3'-C T T C A T A G C T C G-5'.

Use the genetic code to determine the corresponding amino acid sequence of the translated protein.

      DNA Coding Strand:3'- C  T  T  C  A  T  A  G  C  T  C  G -5'

               mRNA Strand:

         Protein Sequence:

Okay, everyone. Consider a DNA coding strand with the following sequence. Use the genetic code to determine the corresponding amino acid sequence of the translated protein. Okay. So we're given a DNA coding strand. We're asked to find the mRNA and then the sequence of amino acids. Alright. So here is our DNA coding strand. Now let's find the mRNA strand. But be careful. They gave us the coding strand, not the template strand. So is the mRNA going to be anti parallel to the coding strand? No. It's going to have the same directionality as the coding strand. Because if you remember, RNA polymerase uses the template strand of DNA as a template to make the mRNA. And the mRNA is anti parallel to the template strand, but so is the coding strand. That means that the mRNA and the coding strand have the same directionality, and they should have the same sequence of nucleotides, except RNA has uracil while DNA has thymine. So just remember those. Be careful because sometimes they could give you the coding strand in a particular question, and sometimes they could give you a template strand. Just keep that in mind. We have a coding strand, so we know that the mRNA should have the same directionality. So it should start with 3' just as the coding strand does, and end in 5' just as the coding strand does. So now we're just going to write the same bases down as seen in the coding strand, except all of these t's are going to be changed to u's. So we have CUU CAU AGC UCG. Oh, got a little close here. CG5'. So that is the code of the mRNA strand. So now we just have to go through the different codons and figure out the associated amino acids. So let's start with the very first codon on the 3' end, CUU. So we go over to our table, we find the first letter, we find the second letter. CUU is right here, so that means we have a leucine as the first amino acid, LEU. So that's the first one. So now, let's move on to the second one, CAU CAU, so that is a histidine, HIS. Then, AGC. Let's remove these. AGC, serine. And then we have UCG. UCG, another serine. Alright. So that is going to be the sequence of amino acids associated with this particular mRNA strand and this coding strand. Okay, everyone. Let's move on to our next video.

Which of the following polypeptide chains are synthesized from the RNA sequence:

5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'

• A. Met-His-Asn-Ser-Glu-Thr-Tyr-Stop.
• B. Met-Ile-Arg-Ser-Gly-Thr-Ala-Stop.
• C. Met-Ile-Ser-Arg-Glu-Thr-Asp-Stop.
• D. Met-Phe-Ala-Ser-Gly-Tyr-Ala-Stop.

Here’s what students ask on this topic:

What is the main difference between transcription and translation?

The main difference between transcription and translation lies in their processes and products. Transcription is the process of synthesizing RNA from a DNA template, resulting in an RNA molecule. This process does not involve a change in the class of macromolecules, as both DNA and RNA are nucleic acids. In contrast, translation is the process of synthesizing proteins from an RNA template. This involves a change in the class of macromolecules, as it converts nucleic acids (RNA) into proteins, which are composed of amino acids.

What enzymes are involved in transcription and translation?

The key enzyme involved in transcription is RNA polymerase. RNA polymerase is responsible for synthesizing RNA from a DNA template. In translation, the primary structure involved is the ribosome. The ribosome facilitates the assembly of amino acids into a protein based on the sequence of the RNA template.

Where do transcription and translation occur in eukaryotic cells?

In eukaryotic cells, transcription occurs in the nucleus. This is because the DNA, which serves as the template for RNA synthesis, is located in the nucleus. Translation, on the other hand, takes place in the cytoplasm. The ribosomes, which are the sites of protein synthesis, are found in the cytoplasm, outside the nucleus.

What is the direction of synthesis for RNA and proteins?

During transcription, RNA is synthesized in the 5' to 3' direction. This means that the RNA molecule is built from its 5' end towards its 3' end. In translation, proteins are synthesized from the N-terminal end to the C-terminal end. The N-terminal end contains the amino group, while the C-terminal end contains the carboxyl group.

Is there a change in the class of macromolecules during transcription and translation?

During transcription, there is no change in the class of macromolecules. Both DNA and RNA are nucleic acids, so the process involves converting one type of nucleic acid into another. However, during translation, there is a change in the class of macromolecules. Translation converts RNA, a nucleic acid, into proteins, which are composed of amino acids.