Table of contents
- 1. Introduction to Genetics(0)
- 2. Mendel's Laws of Inheritance(0)
- 3. Extensions to Mendelian Inheritance(0)
- 4. Genetic Mapping and Linkage(0)
- 5. Genetics of Bacteria and Viruses(0)
- 6. Chromosomal Variation(0)
- 7. DNA and Chromosome Structure(0)
- 8. DNA Replication(0)
- 9. Mitosis and Meiosis(0)
- 10. Transcription(0)
- 11. Translation(0)
- 12. Gene Regulation in Prokaryotes(0)
- 13. Gene Regulation in Eukaryotes(0)
- 14. Genetic Control of Development(0)
- 15. Genomes and Genomics(0)
- 16. Transposable Elements(0)
- 17. Mutation, Repair, and Recombination(0)
- 18. Molecular Genetic Tools(0)
- 19. Cancer Genetics(0)
- 20. Quantitative Genetics(0)
- 21. Population Genetics(0)
- 22. Evolutionary Genetics(0)
11. Translation
The Genetic Code
11. Translation
The Genetic Code: Study with Video Lessons, Practice Problems & Examples
Back to all problems
27PRACTICE PROBLEM
The sequence of an mRNA is 5' AUGUAUUAUUAUUAGUAUUAUUAU 3'. Identify the incorrect statement(s) related to the translation of this mRNA.
The sequence of an mRNA is 5' AUGUAUUAUUAUUAGUAUUAUUAU 3'. Identify the incorrect statement(s) related to the translation of this mRNA.