Table of contents
- 1. Introduction to Genetics(0)
- 2. Mendel's Laws of Inheritance(0)
- 3. Extensions to Mendelian Inheritance(0)
- 4. Genetic Mapping and Linkage(0)
- 5. Genetics of Bacteria and Viruses(0)
- 6. Chromosomal Variation(0)
- 7. DNA and Chromosome Structure(0)
- 8. DNA Replication(0)
- 9. Mitosis and Meiosis(0)
- 10. Transcription(0)
- 11. Translation(0)
- 12. Gene Regulation in Prokaryotes(0)
- 13. Gene Regulation in Eukaryotes(0)
- 14. Genetic Control of Development(0)
- 15. Genomes and Genomics(0)
- 16. Transposable Elements(0)
- 17. Mutation, Repair, and Recombination(0)
- 18. Molecular Genetic Tools(0)
- 19. Cancer Genetics(0)
- 20. Quantitative Genetics(0)
- 21. Population Genetics(0)
- 22. Evolutionary Genetics(0)
11. Translation
The Genetic Code
11. Translation
The Genetic Code: Study with Video Lessons, Practice Problems & Examples
Back to all problems
49PRACTICE PROBLEM
Given the following DNA template strand: 3'- TACGTACGTCGAGGCTATTCTAGG -5', what would be the amino acid sequence of the resulting polypeptide chain assuming that the reading frame begins with the first base of the sequence?
Given the following DNA template strand: 3'- TACGTACGTCGAGGCTATTCTAGG -5', what would be the amino acid sequence of the resulting polypeptide chain assuming that the reading frame begins with the first base of the sequence?