A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA 5′… ACGCAUUACGUGGCUAGACAUUUAGC– CGAUCAGACUAGACAGCGCGCUAGCG– AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC– GAGGGCACAUAGUCUA … 3′ Genomic. 5′… ACGCATTACGTGGCTAGACATTTAGC– Coding CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand TACCTCAAGCCAUAATAGACAGTAGA– DNA CATTGAAAGACATAGATAGACATAGAGA– CTTAGACATACGACGGACATACCAAGAC– GAATACGAACACTATACAGCCUCAGTAGCGC– TAAAGCTGACTCGCGATCAGTCTCGAGGGCA– CATAGTCTA…3′ There is one intron in the DNA sequence shown. Locate the intron and underline the splice site sequences.
10. Transcription
RNA Modification and Processing