Table of contents
- 1. Introduction to Genetics51m
- 2. Mendel's Laws of Inheritance3h 37m
- 3. Extensions to Mendelian Inheritance2h 41m
- 4. Genetic Mapping and Linkage2h 28m
- 5. Genetics of Bacteria and Viruses1h 21m
- 6. Chromosomal Variation1h 48m
- 7. DNA and Chromosome Structure56m
- 8. DNA Replication1h 10m
- 9. Mitosis and Meiosis1h 34m
- 10. Transcription1h 0m
- 11. Translation58m
- 12. Gene Regulation in Prokaryotes1h 19m
- 13. Gene Regulation in Eukaryotes44m
- 14. Genetic Control of Development44m
- 15. Genomes and Genomics1h 50m
- 16. Transposable Elements47m
- 17. Mutation, Repair, and Recombination1h 6m
- 18. Molecular Genetic Tools19m
- 19. Cancer Genetics29m
- 20. Quantitative Genetics1h 26m
- 21. Population Genetics50m
- 22. Evolutionary Genetics29m
18. Molecular Genetic Tools
Genetic Cloning
2:41 minutes
Problem 28a
Textbook Question
Textbook QuestionThe highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.
ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA
GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC
Verified Solution
This video solution was recommended by our tutors as helpful for the problem above
Video duration:
2mPlay a video:
Was this helpful?
Video transcript
Watch next
Master Genetic Cloning with a bite sized video explanation from Kylia Goodner
Start learningRelated Videos
Related Practice
Genetic Cloning practice set
- Problem sets built by lead tutorsExpert video explanations