The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC

Key Concepts

cDNA and Gene Expression

cDNA, or complementary DNA, is synthesized from an mRNA template through the process of reverse transcription. It represents the coding sequence of a gene, excluding introns, and is crucial for understanding gene expression. In this context, the cDNA derived from human pancreatic tissue reflects the mature mRNA that encodes the B chain of insulin, highlighting the differences between the genomic DNA and the expressed sequence.

E. coli as a Host for Protein Production

E. coli is commonly used as a host organism for the production of recombinant proteins, including insulin. This bacterium can be genetically modified to express human proteins, but it lacks the machinery to splice introns from eukaryotic genes. Therefore, when comparing the sequences, the E. coli version would typically contain only the exons, while the human gene may include introns that are absent in the cDNA.

Sequence Alignment and Differences

Sequence alignment is a method used to identify similarities and differences between two sequences of DNA or RNA. In this case, comparing the highlighted E. coli sequence with the human cDNA sequence will reveal variations such as missing introns, differences in nucleotide composition, or mutations. Understanding these differences is essential for grasping how the sequences relate to protein synthesis and functionality.