A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA 5′… ACGCAUUACGUGGCUAGACAUUUAGC– CGAUCAGACUAGACAGCGCGCUAGCG– AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC– GAGGGCACAUAGUCUA … 3′ Genomic. 5′… ACGCATTACGTGGCTAGACATTTAGC– Coding CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand TACCTCAAGCCAUAATAGACAGTAGA– DNA CATTGAAAGACATAGATAGACATAGAGA– CTTAGACATACGACGGACATACCAAGAC– GAATACGAACACTATACAGCCUCAGTAGCGC– TAAAGCTGACTCGCGATCAGTCTCGAGGGCA– CATAGTCTA…3′ Does this intron contain normal splice-site sequences?
Table of contents
- 1. Introduction to Genetics51m
- 2. Mendel's Laws of Inheritance3h 37m
- 3. Extensions to Mendelian Inheritance2h 41m
- 4. Genetic Mapping and Linkage2h 28m
- 5. Genetics of Bacteria and Viruses1h 21m
- 6. Chromosomal Variation1h 48m
- 7. DNA and Chromosome Structure56m
- 8. DNA Replication1h 10m
- 9. Mitosis and Meiosis1h 34m
- 10. Transcription1h 0m
- 11. Translation58m
- 12. Gene Regulation in Prokaryotes1h 19m
- 13. Gene Regulation in Eukaryotes44m
- 14. Genetic Control of Development44m
- 15. Genomes and Genomics1h 50m
- 16. Transposable Elements47m
- 17. Mutation, Repair, and Recombination1h 6m
- 18. Molecular Genetic Tools19m
- 19. Cancer Genetics29m
- 20. Quantitative Genetics1h 26m
- 21. Population Genetics50m
- 22. Evolutionary Genetics29m
10. Transcription
RNA Modification and Processing
Problem 33
Textbook Question
Isoginkgetin is a cell-permeable chemical isolated from the Ginkgo biloba tree that binds to and inhibits snRNPs.
What types of problems would you anticipate in cells treated with isoginkgetin?

1
span>Understand the role of snRNPs: Small nuclear ribonucleoproteins (snRNPs) are essential components of the spliceosome, which is responsible for the splicing of pre-mRNA in eukaryotic cells.
span>Recognize the impact of inhibiting snRNPs: Inhibition of snRNPs by isoginkgetin would likely disrupt the normal splicing process, leading to the accumulation of unspliced pre-mRNA.
span>Consider the consequences of unspliced pre-mRNA: Accumulation of unspliced pre-mRNA can result in the production of non-functional or deleterious proteins, as the mRNA may not be properly processed into mature mRNA.
span>Identify potential cellular problems: Cells may experience issues such as impaired protein synthesis, disrupted cellular functions, and possibly cell death due to the lack of essential proteins.
span>Explore broader implications: On a larger scale, tissues and organs could be affected, leading to physiological dysfunctions depending on the extent and duration of isoginkgetin exposure.

This video solution was recommended by our tutors as helpful for the problem above
Video duration:
1mPlay a video:
Was this helpful?
Key Concepts
Here are the essential concepts you must grasp in order to answer the question correctly.
snRNPs (small nuclear ribonucleoproteins)
snRNPs are essential components of the spliceosome, a complex responsible for the splicing of pre-mRNA in eukaryotic cells. They play a critical role in removing introns from pre-mRNA and joining exons together, which is vital for producing mature mRNA that can be translated into proteins. Inhibition of snRNPs can lead to improper splicing, resulting in dysfunctional proteins and potentially causing cellular stress or apoptosis.
Recommended video:
Guided course
mRNA Processing
mRNA splicing
mRNA splicing is the process by which introns are removed and exons are joined together in pre-mRNA to form mature mRNA. This process is crucial for gene expression, as it determines which protein isoforms are produced. Disruption of splicing due to the inhibition of snRNPs by isoginkgetin could lead to the production of non-functional proteins or the retention of introns, which can severely affect cellular function and viability.
Recommended video:
Guided course
mRNA Processing
cellular stress response
The cellular stress response is a set of mechanisms that cells activate in response to various stressors, including chemical inhibitors like isoginkgetin. When splicing is disrupted, cells may experience an accumulation of unspliced pre-mRNA, leading to stress responses such as the activation of the unfolded protein response (UPR) or apoptosis. Understanding this response is crucial for predicting the potential consequences of treating cells with isoginkgetin.
Recommended video:
Guided course
Translesion Synthesis
Related Videos
Related Practice
Textbook Question
344
views