Table of contents
- 1. Introduction to Genetics51m
- 2. Mendel's Laws of Inheritance3h 37m
- 3. Extensions to Mendelian Inheritance2h 41m
- 4. Genetic Mapping and Linkage2h 28m
- 5. Genetics of Bacteria and Viruses1h 21m
- 6. Chromosomal Variation1h 48m
- 7. DNA and Chromosome Structure56m
- 8. DNA Replication1h 10m
- 9. Mitosis and Meiosis1h 34m
- 10. Transcription1h 0m
- 11. Translation58m
- 12. Gene Regulation in Prokaryotes1h 19m
- 13. Gene Regulation in Eukaryotes44m
- 14. Genetic Control of Development44m
- 15. Genomes and Genomics1h 50m
- 16. Transposable Elements47m
- 17. Mutation, Repair, and Recombination1h 6m
- 18. Molecular Genetic Tools19m
- 19. Cancer Genetics29m
- 20. Quantitative Genetics1h 26m
- 21. Population Genetics50m
- 22. Evolutionary Genetics29m
10. Transcription
RNA Modification and Processing
Problem 31b
Textbook Question
A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA 5′… ACGCAUUACGUGGCUAGACAUUUAGC– CGAUCAGACUAGACAGCGCGCUAGCG– AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC– GAGGGCACAUAGUCUA … 3′ Genomic. 5′… ACGCATTACGTGGCTAGACATTTAGC– Coding CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand TACCTCAAGCCAUAATAGACAGTAGA– DNA CATTGAAAGACATAGATAGACATAGAGA– CTTAGACATACGACGGACATACCAAGAC– GAATACGAACACTATACAGCCUCAGTAGCGC– TAAAGCTGACTCGCGATCAGTCTCGAGGGCA– CATAGTCTA…3′ There is one intron in the DNA sequence shown. Locate the intron and underline the splice site sequences.
![](/channels/images/assetPage/verifiedSolution.png)
1
Identify the genomic coding strand DNA sequence and the corresponding mRNA sequence provided.
Compare the sequences to identify regions in the DNA that are not present in the mRNA, as these regions are likely introns.
Look for consensus splice site sequences at the boundaries of the intron. Typically, these are 'GT' at the 5' end and 'AG' at the 3' end of the intron in the DNA sequence.
Underline the identified splice site sequences in the DNA sequence to indicate the boundaries of the intron.
Verify that the remaining sequences in the DNA match the mRNA sequence, confirming the intron location.
Recommended similar problem, with video answer:
![](/channels/images/assetPage/verifiedSolution.png)
This video solution was recommended by our tutors as helpful for the problem above
Video duration:
4mPlay a video:
Was this helpful?
Key Concepts
Here are the essential concepts you must grasp in order to answer the question correctly.
Gene Structure
A gene consists of coding regions (exons) and non-coding regions (introns). Exons are sequences that are expressed in the final mRNA, while introns are removed during RNA processing. Understanding the structure of a gene is crucial for identifying which parts of the sequence will be retained in the mRNA and which will be spliced out.
Recommended video:
Guided course
Ribosome Structure
RNA Splicing
RNA splicing is the process by which introns are removed from the pre-mRNA transcript, and exons are joined together to form mature mRNA. This process is essential for the correct expression of genes, as it ensures that only the coding sequences are translated into proteins. Recognizing splice sites is key to understanding how mRNA is processed.
Recommended video:
Nucleotide Sequences
Nucleotide sequences are the building blocks of DNA and RNA, consisting of adenine (A), cytosine (C), guanine (G), and thymine (T) in DNA, and uracil (U) in RNA. Analyzing these sequences allows for the identification of specific regions, such as exons and introns, and understanding their roles in gene expression and regulation.
Recommended video:
Guided course
Sanger Sequencing
Watch next
Master mRNA Processing with a bite sized video explanation from Kylia Goodner
Start learningRelated Videos
Related Practice