A portion of a human gene is isolated from the genome and sequ...

Question

A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA 5′… ACGCAUUACGUGGCUAGACAUUUAGC– CGAUCAGACUAGACAGCGCGCUAGCG– AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC– GAGGGCACAUAGUCUA … 3′ Genomic. 5′… ACGCATTACGTGGCTAGACATTTAGC– Coding CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand TACCTCAAGCCAUAATAGACAGTAGA– DNA CATTGAAAGACATAGATAGACATAGAGA– CTTAGACATACGACGGACATACCAAGAC– GAATACGAACACTATACAGCCUCAGTAGCGC– TAAAGCTGACTCGCGATCAGTCTCGAGGGCA– CATAGTCTA…3′ There is one intron in the DNA sequence shown. Locate the intron and underline the splice site sequences.

Accepted Answer

Hi everyone. Let's take a look at this practice problem together. A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of M R N A is isolated from the cytoplasm of human cells. And it is also sequenced which of the following statements accurately describes the sequence of introns and spites in human genes. Now we will read the answer options together in just a bit. But first, let's talk about the introns and spice sites. Now recall that when pre M R N A is made from transcription, it must undergo modification to become mature M R N A for translation. One of those modifications is the removal of introns. So on the screen, I am putting up a drawing that represents a pre M R N A transcript recall that this transcript has both introns and exxons throughout the introns represented by the orange regions are non codeine sequences and they are interspersed in the codeine sequences which are called exxons. The exxons are represented by the blue regions. So spicing is the process of removing those enrons and it recognizes spy sites and there's an enzyme that recognizes the spice sites and it's called splice ozone. So the enzyme spliceosome will recognize specific sequences at the five prime and three prime ends of the introns. So at the five prime end of the Enron, the sequence is a guanine thine. At the three prime end of the Enron, the sequence is an adenine guanine. OK. Now, let's go ahead and take a look at those answer options. We have option. A introns are always located between exxons and their sly sites have a consistent sequence of five prime C T A G three prime in all human genes. Option B introns can be located anywhere in a gene and their fly sites have variable sequences that follow cons consensus patterns typically containing a five prime G T and A three prime A G dyed nucleotide. Option C introns are always located at the beginning of a gene and their sly sites have unique sequences for each human gene. Typically containing a five prime G C and a three prime A T dinucleotide. Option D introns can be located anywhere in a gene and their splice sites have a consistent sequence of five prime G T C G three prime in all human genes. OK. Now that we've reviewed those answer options, we can eliminate options A and C because we know that enrons can be located anywhere, they do not always have to be located between the axons or at the beginning of a gene. Now, option D correctly states that Ron can be located anywhere. However, the splice site sequences is incorrect. So we'll eliminate option D as well. The correct answer is option B, enrons can be located anywhere in a gene and their spy sites have variable sequences that follow consensus patterns, typically containing a five prime G T and a three prime A G dinucleotide. All right, everyone. I hope you've found this helpful and I'll see you soon for the next practice problem.

Key Concepts

Gene Structure

RNA Splicing

Nucleotide Sequences

Watch next