A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA              5′… ACGCAUUACGUGGCUAGACAUUUAGC–                                 CGAUCAGACUAGACAGCGCGCUAGCG–                         AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC–                        GAGGGCACAUAGUCUA … 3′ Genomic.        5′… ACGCATTACGTGGCTAGACATTTAGC– Coding            CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand             TACCTCAAGCCAUAATAGACAGTAGA– DNA                CATTGAAAGACATAGATAGACATAGAGA–                       CTTAGACATACGACGGACATACCAAGAC–                       GAATACGAACACTATACAGCCUCAGTAGCGC–                       TAAAGCTGACTCGCGATCAGTCTCGAGGGCA–                       CATAGTCTA…3′ Does this intron contain normal splice-site sequences?

Key Concepts

Gene Structure

Genes are segments of DNA that contain coding sequences (exons) and non-coding sequences (introns). Exons are expressed in the final mRNA product, while introns are typically removed during RNA processing. Understanding the structure of genes is crucial for analyzing mRNA sequences and determining the presence of splice sites.

Splice Sites

Splice sites are specific sequences at the boundaries of introns and exons that signal where splicing should occur during mRNA processing. The consensus sequences for splice sites are usually located at the 5' end (donor site) and the 3' end (acceptor site) of introns. Identifying these sequences is essential for determining whether an intron contains normal splice-site sequences.

mRNA Processing

After transcription, pre-mRNA undergoes processing to become mature mRNA, which includes the removal of introns and the joining of exons. This process, known as splicing, is critical for generating a functional mRNA that can be translated into protein. Understanding mRNA processing helps in analyzing the relationship between genomic DNA and the resulting mRNA sequences.