Table of contents
- 1. Introduction to Genetics51m
- 2. Mendel's Laws of Inheritance3h 37m
- 3. Extensions to Mendelian Inheritance2h 41m
- 4. Genetic Mapping and Linkage2h 28m
- 5. Genetics of Bacteria and Viruses1h 21m
- 6. Chromosomal Variation1h 48m
- 7. DNA and Chromosome Structure56m
- 8. DNA Replication1h 10m
- 9. Mitosis and Meiosis1h 34m
- 10. Transcription1h 0m
- 11. Translation58m
- 12. Gene Regulation in Prokaryotes1h 19m
- 13. Gene Regulation in Eukaryotes44m
- 14. Genetic Control of Development44m
- 15. Genomes and Genomics1h 50m
- 16. Transposable Elements47m
- 17. Mutation, Repair, and Recombination1h 6m
- 18. Molecular Genetic Tools19m
- 19. Cancer Genetics29m
- 20. Quantitative Genetics1h 26m
- 21. Population Genetics50m
- 22. Evolutionary Genetics29m
10. Transcription
RNA Modification and Processing
Problem 31a
Textbook Question
A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA 5′… ACGCAUUACGUGGCUAGACAUUUAGC– CGAUCAGACUAGACAGCGCGCUAGCG– AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC– GAGGGCACAUAGUCUA … 3′ Genomic. 5′… ACGCATTACGTGGCTAGACATTTAGC– Coding CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand TACCTCAAGCCAUAATAGACAGTAGA– DNA CATTGAAAGACATAGATAGACATAGAGA– CTTAGACATACGACGGACATACCAAGAC– GAATACGAACACTATACAGCCUCAGTAGCGC– TAAAGCTGACTCGCGATCAGTCTCGAGGGCA– CATAGTCTA…3′ Does this intron contain normal splice-site sequences?

1
Identify the typical splice-site sequences in eukaryotic genes, which are the 5' splice site (donor site) with a consensus sequence of GU and the 3' splice site (acceptor site) with a consensus sequence of AG.
Examine the provided mRNA sequence to identify potential splice sites by looking for the GU and AG sequences that could indicate the presence of introns.
Compare the mRNA sequence with the genomic coding strand DNA sequence to determine if there are any regions in the DNA that are not present in the mRNA, suggesting the presence of introns.
Check the regions in the genomic DNA that are absent in the mRNA for the presence of the GU and AG consensus sequences at the boundaries, which would indicate normal splice-site sequences.
If the GU and AG sequences are found at the appropriate positions in the genomic DNA, conclude that the intron contains normal splice-site sequences.

This video solution was recommended by our tutors as helpful for the problem above
Video duration:
2mPlay a video:
Was this helpful?
Key Concepts
Here are the essential concepts you must grasp in order to answer the question correctly.
Gene Structure
Genes are segments of DNA that contain coding sequences (exons) and non-coding sequences (introns). Exons are expressed in the final mRNA product, while introns are typically removed during RNA processing. Understanding the structure of genes is crucial for analyzing mRNA sequences and determining the presence of splice sites.
Recommended video:
Guided course
Ribosome Structure
Splice Sites
Splice sites are specific sequences at the boundaries of introns and exons that signal where splicing should occur during mRNA processing. The consensus sequences for splice sites are usually located at the 5' end (donor site) and the 3' end (acceptor site) of introns. Identifying these sequences is essential for determining whether an intron contains normal splice-site sequences.
Recommended video:
Guided course
mRNA Processing
mRNA Processing
After transcription, pre-mRNA undergoes processing to become mature mRNA, which includes the removal of introns and the joining of exons. This process, known as splicing, is critical for generating a functional mRNA that can be translated into protein. Understanding mRNA processing helps in analyzing the relationship between genomic DNA and the resulting mRNA sequences.
Recommended video:
Guided course
mRNA Processing
Related Videos
Related Practice