A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA              5′… ACGCAUUACGUGGCUAGACAUUUAGC–                                 CGAUCAGACUAGACAGCGCGCUAGCG–                         AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC–                        GAGGGCACAUAGUCUA … 3′ Genomic.        5′… ACGCATTACGTGGCTAGACATTTAGC– Coding            CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand             TACCTCAAGCCAUAATAGACAGTAGA– DNA                CATTGAAAGACATAGATAGACATAGAGA–                       CTTAGACATACGACGGACATACCAAGAC–                       GAATACGAACACTATACAGCCUCAGTAGCGC–                       TAAAGCTGACTCGCGATCAGTCTCGAGGGCA–                       CATAGTCTA…3′ Does this intron contain normal splice-site sequences?